bio.halowerk.com
Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.
The wallet the 402 directs payment to. Its whole payment record — every payer, every chain — is on the merchant page.
Asset 0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913
The payTo wallet does not resolve to a registered ERC-8004 agent. That is not a verdict on the service — most of the catalog is unregistered.
Live 402 challenge
Captured by the enrichment pass, not read just now. Prices can change — always read the 402 the endpoint answers with.
{
"docs": "https://bio.halowerk.com/llms.txt",
"name": "biowerk_crispr_offtarget",
"error": "payment_required",
"accepts": [
{
"asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
"extra": {
"name": "USD Coin",
"asset": "USDC",
"version": "2",
"eip712Domain": {
"name": "USD Coin",
"chainId": 8453,
"version": "2",
"verifyingContract": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913"
},
"network_name": "Base Mainnet",
"assetTransferMethod": "eip3009"
},
"payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
"amount": "4000",
"scheme": "exact",
"network": "eip155:8453",
"currency": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
"recipient": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
"maxTimeoutSeconds": 300
}
],
"pricing": "https://bio.halowerk.com/pricing",
"resource": {
"url": "https://bio.halowerk.com/v1/crispr-offtarget",
"mimeType": "application/json",
"description": "Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision."
},
"extensions": {
"bazaar": {
"info": {
"input": {
"body": {
"guide": "GAGTCCGAGCAGAAGAAGAA",
"candidates": [
{
"id": "candidate-1",
"pam": "AGG",
"protospacer": "GAGTCCGAGCAGAAGAAGAA"
},
{
"id": "candidate-2",
"pam": "TGG",
"protospacer": "GAGTCCGAGCAGAAGATGAA"
},
{
"id": "candidate-3",
"pam": "TGA",
"protospacer": "GACTCCGAGCAGAAGAAGAT"
}
]
},
"type": "http",
"method": "POST",
"bodyType": "json"
}
},
"schema": {
"type": "object",
"$schema": "https://json-schema.org/draft/2020-12/schema",
"required": [
"input"
],
"properties": {
"input": {
"type": "object",
"required": [
"type",
"method",
"bodyType",
"body"
],
"properties": {
"body": {
"type": "object",
"required": [
"guide",
"candidates"
],
"properties": {
"guide": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 30,
"minLength": 17,
"description": "Guide sequence written 5-prime to 3-prime."
},
"candidates": {
"type": "array",
"items": {
"type": "object",
"required": [
"id",
"protospacer",
"pam"
],
"properties": {
"id": {
"type": "string",
"maxLength": 128,
"minLength": 1
},
"pam": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 8,
"minLength": 2
},
"protospacer": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 30,
"minLength": 17
}
},
"additionalProperties": false
},
"maxItems": 1000,
"minItems": 1
}
},
"additionalProperties": false
},
"type": {
"type": "string",
"const": "http"
},
"method": {
"enum": [
"POST",
"PUT",
"PATCH"
],
"type": "string"
},
"bodyType": {
"enum": [
"json",
"form-data",
"text"
],
"type": "string"
}
},
"additionalProperties": false
}
}
}
}
},
"price_usdc": "0.004",
"description": "Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.",
"inputSchema": {
"type": "object",
"required": [
"guide",
"candidates"
],
"properties": {
"guide": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 30,
"minLength": 17,
"description": "Guide sequence written 5-prime to 3-prime."
},
"candidates": {
"type": "array",
"items": {
"type": "object",
"required": [
"id",
"protospacer",
"pam"
],
"properties": {
"id": {
"type": "string",
"maxLength": 128,
"minLength": 1
},
"pam": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 8,
"minLength": 2
},
"protospacer": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 30,
"minLength": 17
}
},
"additionalProperties": false
},
"maxItems": 1000,
"minItems": 1
}
},
"additionalProperties": false
},
"price_model": "per_call",
"x402Version": 2,
"instructions": "Sign the accepted terms with an x402 client and repeat the request with the payment header.",
"payment_header": "PAYMENT-SIGNATURE",
"capability_request": {
"url": "https://bedarf.halowerk.com/capabilities/request",
"cost": "free",
"method": "POST",
"description": "Missing a capability, or does the scope not fit? Report the need here - no payment required. Similar reports are bundled; the response returns an id you can check back on.",
"body_example": {
"max_price": 0.01,
"description": "what exactly is needed",
"requested_capability": "short label"
}
}
}Accepts
The payment requirements as published to the catalog. Read the live 402 before paying — a price here is a claim, not a quote.
Pay 0.004 USDC on Base to 0x2880…C4E5E. The signed payment is good for 5 minutes.
- Paid to
- 0x2880…C4E5E
- USD Coin contract
- 0x8335…02913
- Payment window
- 5 minutes
- As published
- 4000 smallest units
The catalog’s raw entry
[
{
"asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
"extra": {
"name": "USD Coin",
"asset": "USDC",
"version": "2",
"eip712Domain": {
"name": "USD Coin",
"chainId": 8453,
"version": "2",
"verifyingContract": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913"
},
"network_name": "Base Mainnet",
"assetTransferMethod": "eip3009"
},
"payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
"amount": "4000",
"scheme": "exact",
"network": "eip155:8453",
"currency": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
"recipient": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
"maxTimeoutSeconds": 300
}
]Extensions
{
"bazaar": {
"info": {
"input": {
"body": {
"guide": "GAGTCCGAGCAGAAGAAGAA",
"candidates": [
{
"id": "candidate-1",
"pam": "AGG",
"protospacer": "GAGTCCGAGCAGAAGAAGAA"
},
{
"id": "candidate-2",
"pam": "TGG",
"protospacer": "GAGTCCGAGCAGAAGATGAA"
},
{
"id": "candidate-3",
"pam": "TGA",
"protospacer": "GACTCCGAGCAGAAGAAGAT"
}
]
},
"type": "http",
"method": "POST",
"bodyType": "json"
}
},
"schema": {
"type": "object",
"$schema": "https://json-schema.org/draft/2020-12/schema",
"required": [
"input"
],
"properties": {
"input": {
"type": "object",
"required": [
"type",
"method",
"bodyType",
"body"
],
"properties": {
"body": {
"type": "object",
"required": [
"guide",
"candidates"
],
"properties": {
"guide": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 30,
"minLength": 17,
"description": "Guide sequence written 5-prime to 3-prime."
},
"candidates": {
"type": "array",
"items": {
"type": "object",
"required": [
"id",
"protospacer",
"pam"
],
"properties": {
"id": {
"type": "string",
"maxLength": 128,
"minLength": 1
},
"pam": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 8,
"minLength": 2
},
"protospacer": {
"type": "string",
"pattern": "^[ACGT]+$",
"maxLength": 30,
"minLength": 17
}
},
"additionalProperties": false
},
"maxItems": 1000,
"minItems": 1
}
},
"additionalProperties": false
},
"type": {
"type": "string",
"const": "http"
},
"method": {
"enum": [
"POST",
"PUT",
"PATCH"
],
"type": "string"
},
"bodyType": {
"enum": [
"json",
"form-data",
"text"
],
"type": "string"
}
},
"additionalProperties": false
}
}
}
}
}Provenance
- Seen in the source catalog
- 2026-09-20 14:11Z
- Last indexed by Roundhouse
- 2026-09-24 09:40Z
- Last enriched (probe, favicon, geo)
- 2026-09-24 05:46Z
- x402 version
- 2
- Max timeout
- 300s
- Liveness probe
- HTTP 402
Hand this page to an agent
Copy the prompt and paste it into Claude, an MCP client or your own agent — it will vet this service and call it over the free read API. No key, no account.
GET api.roundhouseai.io/v0/endpoints
This endpoint's own trailing-30-day call count, as published by the upstream catalog and snapshotted daily. 23 snapshots so far. Verified volume counts only settlements with an on-chain EIP-3009 marker.
Show the promptHide the prompt
Using Roundhouse, look up the x402 service bio.halowerk.com and tell me whether it is worth paying: what a call costs, whether the endpoint answered when last probed, and what its payment record actually shows. curl -s 'https://api.roundhouseai.io/v0/endpoints?q=bio.halowerk.com' curl -s 'https://api.roundhouseai.io/v0/merchants/<the payTo wallet returned above>' Then call it: read the price from the live 402 at https://bio.halowerk.com/v1/crispr-offtarget, never from a cached figure, and pay with an x402 client. The /v0 API needs an API key (`authorization: Bearer rh_live_…`) on everything except /v0/unified* and /v0/endpoints. Mint a personal key for $0.01 at GET https://api.roundhouseai.io/v0/test/x402, or use an organization key from https://roundhouseai.io/dashboard/team. If you do not have Roundhouse tools or skills installed, read https://roundhouseai.io/skill.md first — it is the whole procedure.