bio.halowerk.com

Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.

OtherLiveeip155:8453Exactvia cdp
Calls · 30d
1→ 0%
This endpoint's own trailing-30-day call count, as published by the upstream catalog and snapshotted daily. 24 snapshots so far.
$11.50
Verified settled volume
2,672 settlements proven x402 by their on-chain EIP-3009 marker.
$0.0040
Listed price
As published in the catalog. Always read the live 402 before paying.
1
Calls · 30d
Upstream's own call count for this endpoint, not ours.
1
Unique payers · 30d
Last called 2026-09-01 07:53Z
—
Upstream on-chain volume
Reported by the source catalog.
Paid to
0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E

The wallet the 402 directs payment to. Its whole payment record — every payer, every chain — is on the merchant page.

Asset 0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913

Provider

The payTo wallet does not resolve to a registered ERC-8004 agent. That is not a verdict on the service — most of the catalog is unregistered.

Live 402 challenge

Captured by the enrichment pass, not read just now. Prices can change — always read the 402 the endpoint answers with.

{
  "docs": "https://bio.halowerk.com/llms.txt",
  "name": "biowerk_phage_matching",
  "error": "payment_required",
  "accepts": [
    {
      "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
      "extra": {
        "name": "USD Coin",
        "asset": "USDC",
        "version": "2",
        "eip712Domain": {
          "name": "USD Coin",
          "chainId": 8453,
          "version": "2",
          "verifyingContract": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913"
        },
        "network_name": "Base Mainnet",
        "assetTransferMethod": "eip3009"
      },
      "payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
      "amount": "4000",
      "scheme": "exact",
      "network": "eip155:8453",
      "currency": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
      "recipient": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
      "maxTimeoutSeconds": 300
    }
  ],
  "pricing": "https://bio.halowerk.com/pricing",
  "resource": {
    "url": "https://bio.halowerk.com/v1/phage-matching",
    "mimeType": "application/json",
    "description": "Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability."
  },
  "extensions": {
    "bazaar": {
      "info": {
        "input": {
          "body": {
            "spacers": [
              {
                "id": "spacer-1",
                "sequence": "GGCTAACCGTTCGATC"
              },
              {
                "id": "spacer-2",
                "sequence": "ATGCCTGAATTCGGCA"
              }
            ],
            "max_mismatches": 2,
            "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA"
          },
          "type": "http",
          "method": "POST",
          "bodyType": "json"
        }
      },
      "schema": {
        "type": "object",
        "$schema": "https://json-schema.org/draft/2020-12/schema",
        "required": [
          "input"
        ],
        "properties": {
          "input": {
            "type": "object",
            "required": [
              "type",
              "method",
              "bodyType",
              "body"
            ],
            "properties": {
              "body": {
                "type": "object",
                "required": [
                  "phage_sequence",
                  "spacers",
                  "max_mismatches"
                ],
                "properties": {
                  "spacers": {
                    "type": "array",
                    "items": {
                      "type": "object",
                      "required": [
                        "id",
                        "sequence"
                      ],
                      "properties": {
                        "id": {
                          "type": "string",
                          "maxLength": 128,
                          "minLength": 1
                        },
                        "sequence": {
                          "type": "string",
                          "pattern": "^[ACGT]+$",
                          "maxLength": 60,
                          "minLength": 15
                        }
                      },
                      "additionalProperties": false
                    },
                    "maxItems": 50,
                    "minItems": 1
                  },
                  "max_mismatches": {
                    "type": "integer",
                    "maximum": 5,
                    "minimum": 0
                  },
                  "phage_sequence": {
                    "type": "string",
                    "pattern": "^[ACGT]+$",
                    "maxLength": 10000,
                    "minLength": 1
                  }
                },
                "additionalProperties": false
              },
              "type": {
                "type": "string",
                "const": "http"
              },
              "method": {
                "enum": [
                  "POST",
                  "PUT",
                  "PATCH"
                ],
                "type": "string"
              },
              "bodyType": {
                "enum": [
                  "json",
                  "form-data",
                  "text"
                ],
                "type": "string"
              }
            },
            "additionalProperties": false
          }
        }
      }
    }
  },
  "price_usdc": "0.004",
  "description": "Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.",
  "inputSchema": {
    "type": "object",
    "required": [
      "phage_sequence",
      "spacers",
      "max_mismatches"
    ],
    "properties": {
      "spacers": {
        "type": "array",
        "items": {
          "type": "object",
          "required": [
            "id",
            "sequence"
          ],
          "properties": {
            "id": {
              "type": "string",
              "maxLength": 128,
              "minLength": 1
            },
            "sequence": {
              "type": "string",
              "pattern": "^[ACGT]+$",
              "maxLength": 60,
              "minLength": 15
            }
          },
          "additionalProperties": false
        },
        "maxItems": 50,
        "minItems": 1
      },
      "max_mismatches": {
        "type": "integer",
        "maximum": 5,
        "minimum": 0
      },
      "phage_sequence": {
        "type": "string",
        "pattern": "^[ACGT]+$",
        "maxLength": 10000,
        "minLength": 1
      }
    },
    "additionalProperties": false
  },
  "price_model": "per_call",
  "x402Version": 2,
  "instructions": "Sign the accepted terms with an x402 client and repeat the request with the payment header.",
  "payment_header": "PAYMENT-SIGNATURE",
  "capability_request": {
    "url": "https://bedarf.halowerk.com/capabilities/request",
    "cost": "free",
    "method": "POST",
    "description": "Missing a capability, or does the scope not fit? Report the need here - no payment required. Similar reports are bundled; the response returns an id you can check back on.",
    "body_example": {
      "max_price": 0.01,
      "description": "what exactly is needed",
      "requested_capability": "short label"
    }
  }
}

Accepts

The payment requirements as published to the catalog. Read the live 402 before paying — a price here is a claim, not a quote.

0.004USDC≈ $0.004 USD
on Base · exact scheme

Pay 0.004 USDC on Base to 0x2880…C4E5E. The signed payment is good for 5 minutes.

USD Coin contract
0x8335…02913
Payment window
5 minutes
As published
4000 smallest units
The catalog’s raw entry
[
  {
    "asset": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
    "extra": {
      "name": "USD Coin",
      "asset": "USDC",
      "version": "2",
      "eip712Domain": {
        "name": "USD Coin",
        "chainId": 8453,
        "version": "2",
        "verifyingContract": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913"
      },
      "network_name": "Base Mainnet",
      "assetTransferMethod": "eip3009"
    },
    "payTo": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
    "amount": "4000",
    "scheme": "exact",
    "network": "eip155:8453",
    "currency": "0x833589fCD6eDb6E08f4c7C32D4f71b54bdA02913",
    "recipient": "0x2880EdfFF13100677Bf97A3CBdF3Bc34771C4E5E",
    "maxTimeoutSeconds": 300
  }
]

Extensions

{
  "bazaar": {
    "info": {
      "input": {
        "body": {
          "spacers": [
            {
              "id": "spacer-1",
              "sequence": "GGCTAACCGTTCGATC"
            },
            {
              "id": "spacer-2",
              "sequence": "ATGCCTGAATTCGGCA"
            }
          ],
          "max_mismatches": 2,
          "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA"
        },
        "type": "http",
        "method": "POST",
        "bodyType": "json"
      }
    },
    "schema": {
      "type": "object",
      "$schema": "https://json-schema.org/draft/2020-12/schema",
      "required": [
        "input"
      ],
      "properties": {
        "input": {
          "type": "object",
          "required": [
            "type",
            "method",
            "bodyType",
            "body"
          ],
          "properties": {
            "body": {
              "type": "object",
              "required": [
                "phage_sequence",
                "spacers",
                "max_mismatches"
              ],
              "properties": {
                "spacers": {
                  "type": "array",
                  "items": {
                    "type": "object",
                    "required": [
                      "id",
                      "sequence"
                    ],
                    "properties": {
                      "id": {
                        "type": "string",
                        "maxLength": 128,
                        "minLength": 1
                      },
                      "sequence": {
                        "type": "string",
                        "pattern": "^[ACGT]+$",
                        "maxLength": 60,
                        "minLength": 15
                      }
                    },
                    "additionalProperties": false
                  },
                  "maxItems": 50,
                  "minItems": 1
                },
                "max_mismatches": {
                  "type": "integer",
                  "maximum": 5,
                  "minimum": 0
                },
                "phage_sequence": {
                  "type": "string",
                  "pattern": "^[ACGT]+$",
                  "maxLength": 10000,
                  "minLength": 1
                }
              },
              "additionalProperties": false
            },
            "type": {
              "type": "string",
              "const": "http"
            },
            "method": {
              "enum": [
                "POST",
                "PUT",
                "PATCH"
              ],
              "type": "string"
            },
            "bodyType": {
              "enum": [
                "json",
                "form-data",
                "text"
              ],
              "type": "string"
            }
          },
          "additionalProperties": false
        }
      }
    }
  }
}

Provenance

Seen in the source catalog
2026-09-01 07:53Z
Last indexed by Roundhouse
2026-09-25 12:40Z
Last enriched (probe, favicon, geo)
2026-09-24 05:46Z
x402 version
2
Max timeout
300s
Liveness probe
HTTP 402
Report

Hand this page to an agent

Copy the prompt and paste it into Claude, an MCP client or your own agent — it will vet this service and call it over the free read API. No key, no account.

GET api.roundhouseai.io/v0/endpoints

This endpoint's own trailing-30-day call count, as published by the upstream catalog and snapshotted daily. 24 snapshots so far. Verified volume counts only settlements with an on-chain EIP-3009 marker.

Open skill.md
Show the prompt
Using Roundhouse, look up the x402 service bio.halowerk.com and tell me whether it is
worth paying: what a call costs, whether the endpoint answered when last probed, and what
its payment record actually shows.

curl -s 'https://api.roundhouseai.io/v0/endpoints?q=bio.halowerk.com'
curl -s 'https://api.roundhouseai.io/v0/merchants/<the payTo wallet returned above>'

Then call it: read the price from the live 402 at https://bio.halowerk.com/v1/phage-matching, never from
a cached figure, and pay with an x402 client.

The /v0 API needs an API key (`authorization: Bearer rh_live_…`) on everything except
/v0/unified* and /v0/endpoints. Mint a personal key for $0.01 at GET https://api.roundhouseai.io/v0/test/x402,
or use an organization key from https://roundhouseai.io/dashboard/team.

If you do not have Roundhouse tools or skills installed, read
https://roundhouseai.io/skill.md first — it is the whole procedure.